Skip to content

Powiązanie między chorobą Parkinsona o wczesnym początku i mutacjami w genie Parkin cd

2 miesiące ago

541 words

Egzony od 2 do 12 amplifikowano jednocześnie w trzech grupach metodą PCR (multiplex PCR): grupa składała się z eksonów 4, 7, 8 i 11; grupa 2 składała się z eksonów 5, 6, 8 i 10; i grupa 3 składała się z eksonów 2, 3, 9 i 12 i kontroli zewnętrznej, C328, sekwencji 328 bp genu transtyretyny na chromosomie 18. Zastosowane startery były takie same jak te opisane przez Kitada i wsp. 9, z wyjątkiem w przypadku startera dla eksonu 3, dla którego użyto starterów egzonów: 5 AATTGTGACCTGGATCAGC3 (Ex3iFor) jako przedni starter i 5 CTGGACTTCCAGCTGGTGGTGAG3 (Ex3iRev) jako starter odwrotny. Przedni starter C328 był 5 ACGTTCCTGATAATGGGATC3 (TTRForHex), a starter odwrotny był 5 CCTCTCTCTACCAAGTGAGG3 (TTR328Rev). Wszystkie startery do przodu znakowano fluorescencyjnie HEX-fosforamidamidem. Produkty PCR (2,5 .l) analizowano za pomocą 5% denaturującej elektroforezy w żelu poliakrylamidowym za pomocą zautomatyzowanego sekwencera (model ABI 377) i GeneScan w wersji 3.1 oraz oprogramowania Genotyper w wersji 1.1.1 (wszystkie z Applied Biosystems). Wszystkie reakcje przeprowadzono co najmniej dwa razy. DNA pacjenta, o którym wiadomo, że ma heterozygotyczną delecję eksonów 8 i 9, było zawsze przetwarzane równolegle jako kontrola wewnętrzna. Obliczyliśmy stosunki wszystkich wysokości pików w danej reakcji, a następnie porównaliśmy stosunki ze stosunkami zmierzonymi w próbce od normalnego osobnika. Porównanie to dało następujące zasady: wartości 0,6 lub niższe zostały zinterpretowane jako wskazujące na heterozygotyczną delecję egzonu; wartości od 0,8 do 1,2 zostały zinterpretowane jako normalne; wartości od 1,3 do 1,7 interpretowano jako wskazujące na heterozygotyczną duplikację eksonu; wartości od 1.8 do 2.3 interpretowano jako wskazujące na homozygotyczną duplikację lub heterozygotyczne potrójne eksonu; a wartości większe niż 2,6 interpretowano jako wskazujące na homozygotyczne potrójne eksonu. Przegrupowanie egzonów zostało potwierdzone tylko wtedy, gdy wszystkie stosunki dotyczące tego egzonu były nieprawidłowe. Konsekwencje przegrupowań na poziomie białka (przesunięcie ramki względem rearanżacji w ramce) wywnioskowano z sekwencji egzonowych opublikowanych przez Kitada i wsp. 9 (numer dostępowy DNA Data Bank of Japan AB009973).
Każda reakcja PCR obejmowała całkowitą objętość 25 .l, 40 ng DNA, 3 mM chlorku magnezu, 0,2 mM każdego trifosforanu deoksynukleozydu i U polimerazy Taq. Denaturację przez 5 minut w 95 ° C śledzono przez 23 cykle składające się z 30 sekund denaturacji w 95 ° C, 45 sekund w hybrydyzacji w 53 ° C i 2,5 minuty wydłużenia w 68 ° C, z końcowym okresem 68 ° C przez 5 minut. Stężenia starterów dobierano tak, aby uzyskać – w fazie wykładniczej PCR (dane nie pokazane) – podobne wysokości pików w każdej reakcji multipleksowej i wahały się od 0,4 do 1,9 uM. Delecje i insercje zasad wywnioskowano z wielkości produktów PCR.
W przypadku 54 pacjentów z indeksem z chorobą rodzinną i 91 pacjentów z indeksem z izolowaną chorobą, nie zaobserwowano rearanżacji egzonów lub delecji lub insercji zasad na obu chromosomach, a zatem nie uwzględniono fenotypu. W związku z tym cały region kodujący genu parkiny (w tym granice egzon-intron) został zsekwencjonowany, jak opisano wcześniej14 u 53 pacjentów z indeksem z chorobą rodzinną i 50 pacjentów z izolowaną chorobą.
To, czy zidentyfikowane warianty parkinów poddane kosegregacji z chorobą oceniono na podstawie genotypowania wszystkich dostępnych członków, dotkniętych lub nie, odpowiednich rodzin
[patrz też: choroba bostońska u dorosłych leczenie, choroba resztkowa, wysypka bostońska u dorosłych ]
[przypisy: odpowiedź na pozew o podwyższenie alimentów wzór, cofnięcie pozwu wzór, izis chmielna ]

0 thoughts on “Powiązanie między chorobą Parkinsona o wczesnym początku i mutacjami w genie Parkin cd”

  1. [..] odnosnik do informacji w naukowej publikacji odnosnie: gabinet medycyny estetycznej[…]