Skip to content

Powiązanie między chorobą Parkinsona o wczesnym początku i mutacjami w genie Parkin czesc 4

1 miesiąc ago

507 words

Ponadto, analizowano 114 chromosomów z większości europejskich, niespokrewnionych kontrolnych, którzy nie mieli zaburzeń ruchowych, pod kątem mutacji punktowych i przegrupowań eksonów reprezentowanych w grupie multipleksowej 3. Zastosowanymi technikami były testy restrykcyjne, elektroforeza w żelu poliakryloamidowym i półilościowa reakcja PCR. analiza. W przypadku mutacji dwupunktowych zastąpienie A przez G nukleotydem 939 komplementarnego DNA (cDNA) i zastąpienie T przez C nukleotydem 1101 cDNA – źle dobrane startery odwrotne zastosowano w celu stworzenia miejsca restrykcyjnego zależnego od punktu poszukuje się mutacji: 5 GGCAGGGAGTAGCCAAGTTGAGGAT3 do trawienia za pomocą Alw I i 5 AGCCCCGCTCCACAGCCAGCGC3 w celu trawienia za pomocą Bst UI (w każdym starterze podkreślony nukleotyd różni się od sekwencji typu dzikiego). Analiza statystyczna
Środki (. SD) porównano z nieparametrycznym testem U Manna-Whitneya. Częstotliwości porównano z testem chi-kwadrat, w razie potrzeby z poprawką Yatesa.
Wyniki
Częstotliwość mutacji w genie parkin
Tabela 1. Tabela 1. Częstość mutacji w genie parkiny w 73 rodzinach z autosomalną recesywną wczesną chorobą Parkinsona i 100 pacjentami z izolowaną chorobą Parkinsona o wczesnym początku. Tabela 2. Tabela 2. Częstotliwość mutacji w genie parkiny u 100 pacjentów z izolowaną chorobą Parkinsona o wczesnym początku, zgodnie z wiekiem początkowym. Dwadzieścia pięć rodzin (56 pacjentów) z autosomalną recesywną chorobą Parkinsona miało homozygotyczne lub złożone heterozygotyczne mutacje na każdym allelu genu parkiny (Tabela 1). Ponadto 11 rodzin (27 pacjentów) z mutacją w jednym allelu uznano za mających chorobę związaną z parkinami, przyjmując założenie, że druga mutacja nie została wykryta za pomocą metod stosowanych w tym badaniu. Tak więc mutacje w genie parkiny wykryto w 36 z 73 rodzin (49 procent), w tym 12 wcześniej opisanych rodzin. 13,14 Wśród 100 pacjentów z izolowaną chorobą Parkinsona 18 (18 procent) miało mutacje parkinów. Częstotliwość mutacji wśród pacjentów spokrewnionych z izolowaną chorobą Parkinsona, która sugeruje dziedziczenie autosomalne recesywne, była podobna do tej u pacjentów z rodzinną chorobą (50 procent vs 62 procent). Częstość występowania mutacji u pacjentów z izolowaną chorobą Parkinsona znacznie się zmniejszyła wraz z wiekiem, kiedy wystąpił: mutacje wykryto u 10 z 13 pacjentów (77 procent) z wiekiem przy początku choroby 20 lat lub młodszych, ale tylko u 2 z 64 pacjentów (3 procent) w wieku od początku do 31 lat (Tabela 2). Sekwencjonowanie genu parkin u 22 z 64 pacjentów z izolowaną chorobą Parkinsona, którzy byli starsi niż 30 lat w momencie wystąpienia objawów, ujawniło mutację punktową tylko u pacjenta. W 14 rodzinach, w których dotknięci członkowie rodziny mieli mutacje parkin na obu chromosomach, żadne z 28 nieskrępowanych rodzeństwa nie miało dwóch mutacji parkinowych, co wskazuje na wysoką penetrację mutacji.
Studia kliniczne
36 rodzin z chorobą Parkinsona i mutacjami parkinowymi oraz 18 pacjentów z izolowaną chorobą Parkinsona i mutacjami parkinowymi pochodziło z różnych regionów: Francji (w 15 przypadkach), Włoch (w 13), Wielkiej Brytanii (w 7), Holandii ( w 3), Hiszpanii (w 3), Niemczech (w 3), Portugalii (w 2), Algierii (w 2) i Libanie, Indiach, Pakistanie, Wietnamie, Japonii i Argentynie (po przypadku każdy).
Tabela 3
[hasła pokrewne: zespół aktywacji makrofagów, bostonka powikłania, choroba bostońska w ciąży ]
[więcej w: posesor choszczno, mapis cieszyn, odpowiedź na pozew o podwyższenie alimentów ]

0 thoughts on “Powiązanie między chorobą Parkinsona o wczesnym początku i mutacjami w genie Parkin czesc 4”